Skip to main content

6

Q1. If the sequence of the coding strand in a transcription unit is written as follows: 5'·ATGCATGCATGCATGCATGCATGCATGC·3'. Write down the sequence of mRNA. 

Solution

The sequence of bases in mRNA will be 5’- AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
Q2.   What is promoter gene? 

Solution

The promoter gene is located adjacent to the operator gene, and it marks the site at which the RNA polymerase enzyme binds.
Q3. List the various markers which are used in DNA fingerprinting. 

Solution

The various markers used in DNA fingerprinting are (i) Restriction endonucleases (ii) Satellite DNA (iii) Radioactive DNA probes
Q4. Why is DNA molecule a more stable genetic material than RNA? Explain.

Solution

Removal of the 2′-hydroxyl group from RNA to form DNA results in a backbone which is less susceptible to cleavage by hydrolysis and thus enables more stable storage of genetic information.
Q5. What is proofreading in DNA synthesis?

Solution

Proofreading in DNA synthesis is the property of certain polymerases, e.g. DNA polymerase, to remove erroneously introduced bases and to replace them with the correct bases.
Q6. Give the site of protein synthesis. 

Solution

Ribosomes serve as the site for protein synthesis. Each ribosome consists of large and small subunits.
Q7. (a) Explain the functions of (i) Promoter (ii) tRNA and (iii) Exons. (b) Differentiate between mRNA and tRNA. 

Solution

(a) (i) The promoter region helps in binding of RNA polymerase to the DNA duplex by recognising the promoter by its sigma subunit in prokaryotes.  (ii) The function of tRNA is to transfer specific amino acids to a growing polypeptide chain during the ribosomal site of protein synthesis.  (iii) Exons are the parts of the gene which represent the codons for creating the protein. Exons are parts of DNA which are converted into mature mRNA. The process by which DNA is used as a template to create mRNA is called transcription. (b)  mRNA  tRNA (i) They are longer and linear in shape. (i) They are shorter and have a clover leaf-like structure. (ii) They carry information from DNA for protein synthesis. (ii) They carry amino acids to mRNA codons for protein synthesis. (iii) They are numerous in number. (iii) They are approximately 60 in number.  
Q8. What is known by semiconservative nature of DNA? 

Solution

DNA replication is called semiconservative because the template strand is conserved in the new DNA double strand. When it is copied, one strand is old and one is new. This occurs each time DNA is replicated. 
Q9. Differentiate between induction and repression. 

Solution

 Induction  Repression (i) It turns the operon on. (i) It turns the operon off. (ii) It starts transcription and translation. (ii) It stops transcription and translation. (iii) It operates in a catabolic pathway. (iii) It operates in an anabolic pathway.  
Q10. Where and when does replication occur?

Solution

Replication occurs in the nucleus during the S phase of the cell cycle in eukaryotes, and replication occurs continuously in prokaryotes.
Q11. What is operon? Name the three types of genes which make up an operon.

Solution

The operon is a functioning unit of genomic DNA which is regulated by a common promoter and regulatory genes. The lac operon consists of three genes which are called structural genes - lac Z, lac Y and lac A. 
Q12. Retroviruses do not follow the central dogma. Comment.

Solution

The genomes of retroviruses are RNA, and they use the enzyme reverse transcriptase to make a DNA template. RNA --> DNA is the violation.
Q13. In the medium where E. coli was growing, lactose was added, which induced the lac operon. But why does the lac operon shut down after some time on addition of lactose in the medium?

Solution

In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it and induces transcription for the synthesis of the enzyme beta-galactosidase. After some time, when the level of the inducer increases, the repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped and the lac operon is shut down.
Q14. What are three major classes of RNA? Mention their functions.

Solution

The three major classes of RNA include tRNA, mRNA and rRNA. The function of tRNA is to transfer specific amino acids to a growing polypeptide chain during the ribosomal site of protein synthesis. The main function of the mRNA is to send the information of how to assemble the amino acids found to form protein in the ribosomes. rRNA are involved in protein synthesis.
Q15. Mention the contribution of genetic maps in human genome project. 

Solution

(i) Genetic maps have been used to find the exact chromosomal location. (ii) They also provide information which helps to prevent inherited disease.
Q16. The sequence of one strand of DNA is written as follows: 5'- ATGCATGCATGCATGCATGCATGCATGC - 3'. Write down the sequence of the complementary strand in 5' ~ 3' direction.

Solution

5’- GCATGCATGCATGCATGCATGCATGCAT-3’.
Q17. Name the enzyme involved in the continuous replication of DNA strand. Mention the polarity of the template strand. 

Solution

DNA-dependent DNA polymerase catalyses polymerisation only in one direction, i.e. the 5’-3’ direction, which creates additional complications at the replication fork. On one strand, the replication is continuous, while on the other, it is discontinuous.
Q18. Name the technique used for separating DNA fragments in the laboratory.

Solution

Gel electrophoresis is used for separating DNA fragments in the laboratory.
Q19. What do you understand by DNA polymorphism? 

Solution

DNA polymorphism is any difference in the nucleotide sequence between individuals. These differences can be single base pair changes, deletions or insertions of a given DNA sequence. SNPs (single nucleotide polymorphisms) are the most common type of DNA polymorphism in humans.
Q20. Name the enzymes which can break and reseal the DNA strand.

Solution

Topoisomerases in eukaryotes and DNA gyrases in prokaryotes break and reseal the DNA strand.
Q21. What is an anticodon? 

Solution

A sequence of three adjacent nucleotides (triplet) in tRNA designating a specific amino acid which binds to a corresponding codon in mRNA during protein synthesis.
Q22. Briefly describe bioinformatics.

Solution

Bioinformatics is the branch of science concerned with the management and analysis of biological information stored in databases. This branch developed after the establishment of genetic engineering techniques, introduction of automated protein and DNA sequencing technologies and the use of computers to store enormous data. This has led to the initiation of sequencing the human genome which was launched as the Human Genome Project.
Q23. In which direction are the leading and lagging strands synthesised during DNA replication? Name the enzyme responsible for this process. 

Solution

The leading and lagging strands are synthesised at the corresponding 5′-3′ and 5′-3′ ends during DNA replication. DNA polymerase is responsible for this process.
Q24. Mention the two steps in activation of amino acid translation.  

Solution

(i) Binding of an amino acid with ATP requires enzymes called amino acyl RNA synthetases. (ii) Amino acid and ATP mediated by the enzyme form amino acyl-AMP-enzyme complex.
Q25. A low level of expression of lac operon occurs all the time. Can you explain the logic behind this phenomenon? 

Solution

A low level of lac operon occurs due to the absence of formation of permeases. Permeases are necessary for the transport of lactose from medium into cells. Due to the failure of transport of lactose into the cell, it will not act as inducer.
Q26. There is a paternity dispute for a child. Which technique can solve the problem? 

Solution

A paternity dispute for a child can be solved by the process of DNA fingerprinting.
Q27. Comment on ‘the utility of variability is the number of tandem repeats during DNA fingerprinting’. 

Solution

Tandemness present in repeats supplies several copies of the sequence for fingerprinting and variations in the nitrogen base sequence in them. It is useful for identification of individuals and their relation by DNA fingerprinting.
Q28. (a) In a nucleus, the number of nucleoside triphosphates is 10 times the number of deoxyribonucleoside triphosphates but only deoxyribonucleotides are added during DNA replication. Suggest a mechanism. (b) Name few enzymes involved in DNA replication other than DNA polymerase and ligase.

Solution

(a) DNA polymerase can identify only deoxyribonucleoside triphosphates and is capable of incorporating them as deoxyribonucleotides. (b) Other than DNA polymerase and ligase, the enzymes involved in DNA replication are primase, gyrase and topoisomerase.
Q29. Why does DNA replication start from the 5′ end?

Solution

DNA replication goes in the 5′ to 3′ direction because DNA polymerase acts on the 3′-OH of the existing strand for adding free nucleotides.
Q30. Explain the dual function of AUG codon. Give the sequence of bases it is transcribed from and its anticodon. 

Solution

AUG codon has dual function because (i) It codes for the amino acid methionine (ii) It also acts as an initiator codon. The sequence of bases it is transcribed from is TAC. The sequence of bases in its anticodon is UAC.
Q31. What is a nucleosome?

Solution

A nucleosome is any of the repeating subunits of chromatin, consisting of a DNA chain coiled around a core of histones.
Q32. Explain (a) Cistron, (b) Operator gene and (c) Promoter gene.

Solution

(a) A segment of DNA which encodes for the formation of a specific polypeptide chain is called cistron. (b) An operator is a segment of DNA which a regulatory protein binds to. (c) A site in a DNA molecule at which RNA polymerase and transcription factors bind to initiate transcription of specific genes to mRNA.
Q33. Explain briefly what is meant by DNA ~ RNA ~ protein. 

Solution

It is the central dogma of life in which genetic information flows from nucleic acids to protein. According to the central dogma, the flow of information takes place from DNA to RNA and from RNA to proteins.
Q34. How did Hershey and Chase differentiate between DNA and protein in their experiment, while proving DNA is the genetic material?  

Solution

Hershey and Chase grew some bacteriophages on a medium containing radioactive phosphorus (32P) to identify DNA and some on a medium containing radioactive sulphur (35S) to identify protein. Then these radioactive-labelled phages were allowed to infect E. coli bacteria subjected to the process of centrifugation. It gave an idea that DNA acted as hereditary material which was transmitted from bacteriophage to bacteria. Bacteria which were infected with bacteriophages had radioactive proteins.
Q35. (a) In the human genome, which one of the chromosomes has the most genes and which has the fewest? (b) Scientists have identified about 1.4 million single nucleotide polymorphs in the human genome. How is this information of their existence going to help scientists? 

Solution

(a) Chromosome 1 has the most genes (2968) and chromosome Y has the fewest genes (231). (b) Nucleotide polymorphs are used in DNA fingerprinting and mapping of the human genome.
Q36. What are the functions of mRNA and tRNA? What anticodons will be required to recognise the following codons: (i) AAU, (ii) CGA, (iii) UAU and (iv) GCA?  

Solution

mRNA carries a message from DNA to ribosomes in the form of a sequence of triplet codes. It acts as a platform where protein synthesis takes place. tRNA transfers amino acids to the protein-synthesising apparatus. The anticodons are (i) UUA, (ii) GCU, (iii) AUA and (iv) CGU.
Q37. Define Variable Number Tandem Repeats.

Solution

A tandem repeat from a single genetic locus in which the number of repeated DNA segments varies from individual to individual. It is used in DNA fingerprinting. 
Q38. Write the names of various nitrogenous bases found in RNA. 

Solution

Adenine, Uracil, Guanine, Cytosine 
Q39. What is the difference between the function of primase and DNA polymerase? 

Solution

Primase catalyses the formation of a primer which is polyribonucleotide. It is the starting block during DNA replication. DNA polymerase polymerises the formation of DNA during DNA replication.
Q40. Mention two additional processing which hnRNA needs to undergo after splicing so as to become functional. 

Solution

hnRNA undergoes additional processing called capping and tailing.


Comments