Q1. If the sequence of the coding strand in a
transcription unit is written as follows: 5'·ATGCATGCATGCATGCATGCATGCATGC·3'.
Write down the sequence of mRNA.
Solution
The sequence of bases in mRNA will be
5’- AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
Q2.
What is promoter
gene?
Solution
The promoter gene
is located adjacent to the operator gene, and it marks the site at which the
RNA polymerase enzyme binds.
Q3. List the various
markers which are used in DNA fingerprinting.
Solution
The various markers
used in DNA fingerprinting are
(i) Restriction endonucleases
(ii) Satellite DNA
(iii) Radioactive
DNA probes
Q4. Why is DNA molecule
a more stable genetic material than RNA? Explain.
Solution
Removal of the 2′-hydroxyl
group from RNA to form DNA results in a backbone which is less susceptible to
cleavage by hydrolysis and thus enables more stable storage of genetic
information.
Q5. What is
proofreading in DNA synthesis?
Solution
Proofreading in DNA
synthesis is the property of certain polymerases, e.g. DNA polymerase, to remove
erroneously introduced bases and to replace them with the correct bases.
Q6. Give the site of
protein synthesis.
Solution
Ribosomes serve as the site
for protein synthesis. Each ribosome consists of large and small subunits.
Q7. (a) Explain
the functions of (i) Promoter (ii) tRNA and (iii) Exons.
(b) Differentiate between mRNA and tRNA.
Solution
(a) (i) The promoter region helps in
binding of RNA polymerase to the DNA duplex by recognising the promoter by
its sigma subunit in prokaryotes.
(ii) The function of tRNA is to transfer specific amino acids to a growing
polypeptide chain during the ribosomal site of protein synthesis.
(iii) Exons
are the parts of the gene which represent the codons
for creating the protein. Exons are parts of DNA
which are converted into mature mRNA. The process by which DNA is used as a
template to create mRNA is called transcription.
(b)
mRNA
tRNA
(i) They are longer and
linear in shape.
(i) They are shorter and
have a clover leaf-like structure.
(ii) They carry information from DNA for protein
synthesis.
(ii) They carry amino acids to mRNA codons for protein synthesis.
(iii) They are numerous in number.
(iii) They are approximately 60 in number.
Q8. What is known by semiconservative nature of DNA?
Solution
DNA replication is
called semiconservative because the template strand
is conserved in the new DNA double strand. When it is copied, one strand is
old and one is new. This occurs each time DNA is replicated.
Q9. Differentiate
between induction and repression.
Solution
Induction
Repression
(i) It turns the operon on.
(i) It turns the operon off.
(ii) It starts
transcription and translation.
(ii) It stops
transcription and translation.
(iii) It operates
in a catabolic pathway.
(iii) It operates
in an anabolic pathway.
Q10. Where and when does
replication occur?
Solution
Replication occurs
in the nucleus during the S phase of the cell cycle in eukaryotes, and replication
occurs continuously in prokaryotes.
Q11. What is operon? Name the three types of genes
which make up an operon.
Solution
The operon is a
functioning unit of genomic DNA which is regulated by a common promoter and
regulatory genes.
The lac operon consists of three
genes which are called structural genes - lac Z, lac Y and lac A.
Q12. Retroviruses do not
follow the central dogma. Comment.
Solution
The genomes of
retroviruses are RNA, and they use the enzyme reverse transcriptase to make a
DNA template. RNA --> DNA is the violation.
Q13. In the medium
where E. coli was growing, lactose was added, which induced the lac operon.
But why does the lac operon shut down after some time on addition of lactose
in the medium?
Solution
In lac operon, lactose acts
as an inducer. It binds to the repressor and inactivates it and induces
transcription for the synthesis of the enzyme beta-galactosidase.
After some time,
when the level of the inducer increases, the repressor binds to the operator
gene and prevents RNA polymerase from transcribing the operon.
Hence, the transcription is stopped and the lac operon is shut down.
Q14. What
are three major classes of RNA? Mention their functions.
Solution
The
three major classes of RNA include tRNA, mRNA and rRNA.
The
function of tRNA is to transfer specific amino
acids to a growing polypeptide chain during the ribosomal site of protein
synthesis.
The
main function of the mRNA is to send the information of how to assemble the
amino acids found to form protein in the ribosomes.
rRNA are involved in
protein synthesis.
Q15. Mention
the contribution of genetic maps in human genome project.
Solution
(i) Genetic maps have been used to find the exact
chromosomal location.
(ii) They also
provide information which helps to prevent inherited disease.
Q16. The sequence of one strand of DNA is
written as follows:
5'- ATGCATGCATGCATGCATGCATGCATGC - 3'. Write down the sequence of the complementary
strand in 5' ~ 3' direction.
Solution
5’-
GCATGCATGCATGCATGCATGCATGCAT-3’.
Q17. Name the enzyme
involved in the continuous replication of DNA strand. Mention the polarity of
the template strand.
Solution
DNA-dependent DNA
polymerase catalyses polymerisation only in one direction, i.e. the 5’-3’
direction, which creates additional complications at the replication fork. On
one strand, the replication is continuous, while on the other, it is
discontinuous.
Q18. Name the technique
used for separating DNA fragments in the laboratory.
Solution
Gel electrophoresis
is used for separating DNA fragments in the laboratory.
Q19. What do you
understand by DNA polymorphism?
Solution
DNA
polymorphism is any difference in the nucleotide sequence between
individuals. These differences can be single base pair changes, deletions or
insertions of a given DNA sequence.
SNPs (single
nucleotide polymorphisms) are the most common type of DNA polymorphism in
humans.
Q20. Name the enzymes which
can break and reseal the DNA strand.
Solution
Topoisomerases in eukaryotes and
DNA gyrases in prokaryotes break and reseal the DNA
strand.
Q21. What is an anticodon?
Solution
A sequence of three adjacent nucleotides
(triplet) in tRNA designating a specific amino
acid which binds
to a corresponding
codon in
mRNA during protein
synthesis.
Q22. Briefly
describe bioinformatics.
Solution
Bioinformatics is
the branch of science concerned with the management and analysis of
biological information stored in databases. This branch developed after the establishment
of genetic engineering techniques, introduction of automated protein and DNA
sequencing technologies and the use of computers to store enormous data. This
has led to the initiation of sequencing the human genome which was launched
as the Human Genome Project.
Q23. In which direction are
the leading and lagging strands synthesised during DNA replication? Name the
enzyme responsible for this process.
Solution
The leading and
lagging strands are synthesised at the corresponding 5′-3′ and 5′-3′ ends
during DNA replication.
DNA polymerase is
responsible for this process.
Q24. Mention the two steps in activation of
amino acid translation.
Solution
(i) Binding of an amino acid with ATP requires enzymes
called amino acyl RNA synthetases.
(ii) Amino acid and
ATP mediated by the enzyme form amino acyl-AMP-enzyme
complex.
Q25. A low level of
expression of lac operon occurs all the time. Can you explain the logic
behind this phenomenon?
Solution
A low level of lac operon occurs due to the
absence of formation of permeases. Permeases are necessary for the transport of lactose from
medium into cells. Due to the failure of transport of lactose into the cell,
it will not act as inducer.
Q26. There is a paternity
dispute for a child. Which technique can solve the problem?
Solution
A paternity dispute
for a child can be solved by the process of DNA fingerprinting.
Q27. Comment
on ‘the utility of variability is the number of tandem repeats during DNA
fingerprinting’.
Solution
Tandemness present in repeats
supplies several copies of the sequence for fingerprinting and variations in
the nitrogen base sequence in them. It is useful for identification of
individuals and their relation by DNA fingerprinting.
Q28. (a) In a nucleus, the
number of nucleoside triphosphates is 10 times the
number of deoxyribonucleoside triphosphates
but only deoxyribonucleotides are added during DNA
replication. Suggest a mechanism.
(b) Name few enzymes
involved in DNA replication other than DNA polymerase and ligase.
Solution
(a) DNA polymerase
can identify only deoxyribonucleoside triphosphates and is capable of incorporating them as deoxyribonucleotides.
(b) Other than DNA
polymerase and ligase, the enzymes involved in DNA
replication are primase, gyrase
and topoisomerase.
Q29. Why does DNA
replication start from the 5′ end?
Solution
DNA replication
goes in the 5′ to 3′ direction because DNA polymerase acts on the 3′-OH of
the existing strand for adding free nucleotides.
Q30. Explain the dual
function of AUG codon. Give the sequence of bases
it is transcribed from and its anticodon.
Solution
AUG codon has dual function because
(i) It codes for the amino acid methionine
(ii) It also acts
as an initiator codon.
The sequence of
bases it is transcribed from is TAC.
The sequence of
bases in its anticodon is UAC.
Q31. What is a nucleosome?
Solution
A nucleosome is any of the repeating subunits of chromatin,
consisting of a DNA chain coiled around a core of histones.
Q32. Explain
(a) Cistron, (b) Operator gene and (c) Promoter
gene.
Solution
(a) A segment of DNA which encodes for the formation of a specific
polypeptide chain is called cistron.
(b) An
operator is a segment of DNA which a regulatory protein binds to.
(c) A site in a DNA
molecule at which RNA polymerase and transcription factors bind to initiate
transcription of specific genes to mRNA.
Q33. Explain briefly what
is meant by DNA ~ RNA ~ protein.
Solution
It is the central
dogma of life in which genetic information flows from nucleic acids to
protein. According to the central dogma, the flow of information takes place
from DNA to RNA and from RNA to proteins.
Q34. How
did Hershey and Chase differentiate between DNA and protein in their
experiment, while proving DNA is the genetic material?
Solution
Hershey and Chase grew some bacteriophages
on a medium containing radioactive phosphorus (32P) to identify
DNA and some on a medium containing radioactive sulphur (35S) to
identify protein. Then these radioactive-labelled phages were allowed to
infect E. coli bacteria subjected to the process of centrifugation.
It gave an idea
that DNA acted as hereditary material which was transmitted from bacteriophage to bacteria. Bacteria which were infected
with bacteriophages had radioactive proteins.
Q35. (a)
In the human genome, which one of the chromosomes has the most genes and
which has the fewest?
(b) Scientists have identified about 1.4 million single nucleotide polymorphs
in the human genome. How is this information of their existence going to help
scientists?
Solution
(a) Chromosome
1 has the most genes (2968) and chromosome Y has the fewest genes (231).
(b) Nucleotide
polymorphs are used in DNA fingerprinting and mapping of the human genome.
Q36. What are the functions of mRNA and tRNA? What anticodons will be
required to recognise the following codons: (i) AAU, (ii) CGA, (iii) UAU and (iv) GCA?
Solution
mRNA carries a message from DNA to ribosomes in
the form of a sequence of triplet codes. It acts as a platform where protein
synthesis takes place.
tRNA transfers amino
acids to the protein-synthesising apparatus.
The anticodons are (i) UUA, (ii)
GCU, (iii) AUA and (iv) CGU.
Q37. Define Variable Number Tandem Repeats.
Solution
A tandem repeat
from a single genetic locus in which the number of repeated DNA segments
varies from individual to individual. It is used in DNA fingerprinting.
Q38. Write the names of various nitrogenous bases found in
RNA.
Solution
Adenine, Uracil, Guanine,
Cytosine
Q39. What is the difference
between the function of primase and DNA polymerase?
Solution
Primase catalyses the formation of a primer which is polyribonucleotide. It
is the starting block during DNA replication.
DNA polymerase
polymerises the formation of DNA during DNA replication.
Q40. Mention
two additional processing which hnRNA needs to
undergo after splicing so as to become functional.
Solution
hnRNA undergoes
additional processing called capping and tailing.
Comments
Post a Comment